Polymorphisms in CLEC5A and CLEC7A genes modify risk for inflammatory bowel disease

Introduction

Inflammatory bowel disease (IBD) is a collective term that comprises 2 clinically discrete nosological entities of the intestines, namely Crohn’s disease (CD) and ulcerative colitis (UC). IBD is a global health concern that accounted for 4.9 million cases worldwide in 2019, marking an increase of over 47% compared to 1990 [1]. Because of its physical history, IBD is associated with high rates of hospitalization, an increased risk for abdominal surgery and colorectal cancer, and a large financial burden due to medical expenditures and a significant loss of productive potential [2,3]. Although the etiology of IBD has not been fully elucidated, the contemporary view of CD and UC highlights a multifactorial dynamic interplay between genetic variants and environmental factors that reciprocally incite and perpetuate a relapsing–remitting inflammatory cycle. In genetically susceptible subjects, a dysregulated immune response functions against a dysbiotic commensal microbiome that has been shaped by environmental determinants. The influence of extrinsic triggers may account for the nonuniform geographic distribution of disease incidence and prevalence, since developed, newly industrialized and developing countries are in different epidemiological stages of IBD evolution [4]. Among the several factors that may contribute to the development of disease, major environmental drivers include dietary composition, smoking (increased risk for CD, yet protective for UC), low vitamin D levels, oral contraceptives, and pollution of air and water [5].

Regarding the genetic background of IBD, the use of genome-wide association studies has pinpointed more than 230 loci as contributory to IBD pathogenesis [6]. Although a fraction of them are implicated in both CD and UC, most loci exhibit disease specificity. NOD2/CARD15 comprises the first and most studied locus, correlated with both adult [7] and pediatric-onset CD [8]. Polymorphisms in the autophagy genes ATG16L1 and IRGM and the intelectins (ITLN1) also confer susceptibility, primarily to CD [9]. The panel of risk loci and gene mutations associated with IBD is being consistently enriched with new candidates [10-12].

Recently, Elleisy et al [13] and Iliev et al [14] studied the associations of single nucleotide polymorphisms (SNPs) rs1285933 in the CLEC5A gene with CD, and rs2078178 and rs16910631 in the CLEC7A gene with CD and UC. C-type lectin domain family 5 member A (CLEC5A) and C-type lectin domain family 7 member A (CLEC7A) are type II transmembrane proteins that are members of group V of the C-type lectin receptor (CLR) superfamily [15]. CLEC5A is a spleen tyrosine kinase (SYK)-coupled CLR, primarily expressed on immune cells of the myeloid lineage. Upon binding microbial and nonmicrobial antigens, CLEC5A forms multivalent agglomerates with CLRs and toll-like receptors, leading to downstream signaling that promotes secretion of proinflammatory cytokines and chemokines and induces acquisition of the proinflammatory M1 phenotype in macrophages [15]. CLEC5A induction plays a critical role in the pathogenesis of severe Dengue virus [16] and influenza type A infection [17], Pseudomonas and SARS-CoV-2-induced neutrophil extracellular traps and thromboinflammation [18], and myocardial dysfunction following myocardial infarction [19]. On the other hand, CLEC5A deletion prevents macrophage polarization, NLRP3 inflammasome activation and pyroptosis [19]. Furthermore, in a pan-cancer analysis, CLEC5A was found to be consistently upregulated in analyses of single cancer cells, with higher levels of expression being correlated with macrophage infiltration and worse clinical outcomes [20]. In the context of IBD, significantly higher CLEC5A expression was reported in peripheral blood mononuclear cells of patients with CD compared to healthy individuals [21]. A high CLEC5A to CDH2 ratio (high risk >3) in whole-blood transcriptomic analysis was indicative of the need for treatment escalation in UC [22].

CLEC7A (Dectin-1) is expressed predominantly on myeloid cells and to a lesser degree on subsets of B and T cells [23]. β-glucans comprise the primary Dectin-1 ligand, although recent studies have reported a set of endogenous molecules engaged by Dectin-1, including galectin-9, annexins, vimentin, tropomyosin and N-glycan [24]. Upon stimulation by fungal β-1,3 glycans, Dectin-1 signals via a SYK-dependent or independent route to regulate an antifungal defense response in the form of cytokine production, phagocytosis and respiratory burst. Consequently, CLEC7A -/- mice are highly vulnerable to invasive fungal disease, because of their impaired phagocytic response [25]. Importantly, apart from its protective role in the context of fungal infections, intestinal CLEC7A expression modifies the composition of gut microbiota, as it restricts colonization by opportunistic fungi, including Candida spp. and Trichosporon spp., preserves Saccharomyces cerevisiae proportion, and thus prevents fungal gut dysbiosis [14]. The studies of Iliev et al, Wang et al and Tang et al have addressed the functional implications of CLEC7A deletion in mouse models of colitis, yielding conflicting results [14,26,27].

The scarcity and relative discrepancy between currently published data implies a need for further studies in order to conclusively address the role of CLEC7A and CLEC5A in IBD pathogenesis. The present study aimed to investigate whether polymorphisms in the CLEC5A and CLEC7A genes contribute to the risk for IBD in a well-characterized cohort of Greek patients with IBD, and healthy individuals. Our work provides further insights into the association between CLEC5A and CLEC7A polymorphisms and the risk for CD and UC development. Furthermore, this is first study on the correlation between CLEC5A gene polymorphisms and the risk for UC.

Patients and methods

Patients

Two hundred six patients with an endoscopic and histological diagnosis of IBD, according to the ECCO-ESGAR guidelines [28], were included in the present study. The entire cohort was followed on an outpatient basis by the Department of Gastroenterology of Aretaieion University Hospital in Athens, Greece. One hundred twelve patients had CD (66 male, mean age 38.98±14.42 years) and 94 patients had UC (48 male, mean age 34.4±15.2 years). A total of 164 sex- and age-matched healthy individuals (94 male, mean age 37.43±13.33 years), evaluated in the same institution, served as the control group. Detailed demographic characteristics and clinical features of the enrolled patients and healthy individuals are presented in Table 1.

Table 1 Demographic characteristics of Crohn’s disease patients, ulcerative colitis patients and healthy individuals

DNA isolation and genotyping

Genomic DNA was extracted from peripheral whole blood samples of recruited IBD patients and healthy individuals using the Nucleospin Blood kit (Macherey-Nagel GmbH and Co. KG, Düren, Germany), according to the manufacturer’s instructions. Three SNPs of 2 genes were evaluated in the present study, namely rs2078178 and rs16910631 of CLEC7A, and rs1285933 of CLEC5A. The rs2078178 variant (G/A) and the rs16910631(C/T) in the CLEC7A gene were genotyped by allele-specific polymerase chain reaction (PCR) (Table 2). For the rs2078178 an amplification of a 188 bp fragment using 2 allele-specific forward primers F (G): 5’-AAACTGCCTAGGGGGACTGC-3’ and F (A): 5’-AAACTGCCTAGGGGGACTGT-3’ was used, in combination with a common reverse primer R: 5’-ACCTGACATCAACCTAGAGAGAAG-3’, and for the rs16910631 an amplification of a 185 bp fragment using the allele-specific forward primers F(C): TCTCAAAGGATTATTGCGGGAATTAAAC and F(T): TCTCAAAGGATTATTGCGGGAATTAAAT, with the common reverse primer R: GGCAACCTATTGAGGAAGCG. The rs1285933 polymorphism of the CLEC5A gene was genotyped by RFLP-PCR using the primers F: GGGATCACTGGGTCAAATGGTAT and R: CCTTTCGTGTATTGTTCATCCAGC. The 191 bp product was digested overnight AluI (Enzyquest, Crete, Greece).

Table 2 Polymerase chain reaction primers and reaction conditions for the studied SNPs

Results

Genotype and allele distributions for SNPs rs2078178, rs16910631 in the CLEC7A gene and SNP rs1285933 in CLEC5A are detailed in Tables 3-5. The CLEC7A rs2078178 AA genotype presented a higher frequency in IBD patients compared to healthy individuals, but the AA genotype was significantly associated only with UC (P=0.0035; OR 14.000, 95%CI 1.677-116.88). The heterozygous genotype was not significantly correlated with either CD or UC. A marginally non-significant association was observed between the rs2078178 A allele and UC (P=0.0573; OR 1.543, 95%CI 1.005-2.368). The CLEC7A rs16910631 CT genotype was significantly over-represented in UC patients compared to healthy individuals (P=0.0309; OR 1.949, 95%CI 1.077-3.527), while the correlation with CD did not reach statistical significance. The CLEC5A rs1285933 GA genotype appeared to confer a protective effect against UC (P=0.04; OR 0.4952, 95%CI 0.2573-0.9529) and CD (P<0.0001; OR 0.2721, 95%CI 0.1511-0.4868). Moreover, the presence of the rs1285933 AA genotype also conferred a significantly lower susceptibility to CD development (P=0.0003; OR 0.1697, 95%CI 0.0634-0.4542).

Table 3 CLEC7A rs2078178 genotype and allele distributions among CD/UC cases and healthy individuals

Table 4 CLEC7A rs16910631 genotype and allele distributions among CD/UC cases and healthy individuals

Table 5 CLEC5A rs1285933 genotype and allele distributions among CD/UC cases and healthy individuals

Discussion

The genetic background of IBD remains the focus of extensive research aiming at elucidating susceptibility genes and causal variants. Although current studies have identified more than 230 high-risk loci [6], only limited data have been published about candidate genes and their causal genetic variants. In the present study, we present the genotype and allele frequencies for the rs2078178 and rs16910631 polymorphisms of the CLEC7A gene and the rs1285933 polymorphism of the CLEC5A gene in a Greek cohort of 206 IBD patients, compared to their frequencies in healthy individuals. The correlation between CLEC7A SNPs rs2078178 and rs16910631 and UC has been previously discussed by Iliev et al [14], while an association analysis of the abovementioned SNPs and CLEC5A SNP rs1285933 with CD has been published by Elleisy et al [13]. The latter study reported a significant positive association between the SNP rs1285933 in the CLEC5A gene and the risk for CD (P=0.0523) [13]. Interestingly, CLEC7A gene SNPs rs2078178 and rs16910631, previously significantly associated with medically refractory UC by Iliev et al (P=0.007) [14], were not significantly correlated with the risk for CD. In view of the scanty data, our study aimed to provide further evidence regarding a potential association between CLEC5A and CLEC7A gene polymorphisms and the risk for IBD development. Importantly, this is the first genetic analysis to study the possible association of CLEC5A rs1285933 with the risk for UC development. Furthermore, this is the first study of the CLEC5A and CLEC7A genes in a Greek cohort: we report allele frequencies for the rs2078178 and rs16910631 SNPs of the CLEC7A gene, and for rs1285933 of CLEC5A, in both IBD patients and healthy individuals.

The CLEC5A rs1285933 GA genotype was significantly under-represented in UC and CD patients compared to healthy individuals, implying a protective effect. This negative association between the GA genotype and the risk for CD development was also described by Elleisy et al, although with marginal non-significance (P=0.054; OR 0.65, 95%CI 0.42-1.01) [13]. The AA genotype was protective against CD, but not against UC. Similarly, A-allele carrier status was linked to a significantly lower susceptibility to CD, whereas this correlation did not reach statistical significance for UC. These findings are not in accordance with previously published results by Elleisy et al, who reported a positive association between genotype AA of rs1285933 and risk for CD development (P=0.009; OR 1.90, 95%CI 1.18-3.05) [13]. The disparity observed between our findings and the published literature warrants further studies with larger cohorts to test the data provided in our study. Investigating these correlations in an ethnically diverse study population would also be appropriate, as interethnic variations could potentially account for these conflicting results. Supporting this rationale, Walker et al reported that polymorphisms of genes ATG16L1, IRGM and IL23R that were significantly associated with IBD development in western populations, were not associated with a heightened risk for IBD in Indian Asians. In the same study, the SNP frequencies also differed considerably between European and South Asian IBD patients [29].

CLEC5A shows a high expression in leukocytes (including monocytes, neutrophils and dendritic cells) and has been reported to interact directly with virions. This interaction is mediated by terminal fucose and mannose moieties of viral-derived glycans [15]. There is a great deal of evidence to suggest a link between inflammatory disorders, such as IBD, and CLEC5A. Activation of CLEC5A leads to enhanced recruitment of inflammatory macrophages and neutrophils in autoimmune inflammatory conditions [30]. CLEC5A has been reported to participate in innate immunity through the production of different proinflammatory cytokines and chemokines after stimulation with pathogens [16,31], while it is known that impaired bacterial clearance is an aggravating factor in CD pathogenesis [32]. CLEC5A expression has been found to be greater in patients with IBD compared with age and sex-matched controls [33], and more specifically to be highest in CD patients who are heterozygous for NOD2 disease-causing mutations, thus supporting the hypothesis that both proteins may interact within a regulatory network that is involved in the pathophysiology of CD [21,34]. Targeting CLEC5A either directly, or via its receptor or signaling pathways in which it is involved, such as TREM-1/CLEC5A, reduced the release of proinflammatory cytokines and improved the clinical signs of different pathological states such as chronic obstructive pulmonary disease [35], autoimmune arthritis [30], and intestinal inflammation during colitis [36,37]. Macrophages highly expressing CLEC5A that present proinflammatory characteristics were found to be abundant in the intestinal lamina propria of IBD patients [38].

Dectin-1, the gene product of CLEC7A, is involved in the regulation of antifungal defense mechanisms and the modification of fungal and bacterial gut microbiota. Fungal microbiota distortion is implicated in IBD pathogenesis, as elevated levels of Candida albicans (C. albicans) [39-41] and decreased levels of Ascomycota, especially Saccharomyces cerevisiae (S. cerevisiae) [40,41], have been consistently reported in patients with IBD. C. albicans has been identified as an inducer of anti-S. cerevisiae antibodies in humans, which serve as valuable immunological markers for CD [42]. Yu et al have reported that fungal dysbiosis enhances oxidative phosphorylation by enhancing glutaminolysis in CD4 cells through the Dectin-1-Syk-NF-κB pathway, an effect that is thought to support proinflammatory cytokine production [43]. An upregulation of Dectin-1 expression is observed in macrophages and other immune cell types participating in the inflammatory cascades associated with IBD; however, this finding is not limited to IBD, as it extends to inflammation associated with non-IBD conditions, such as diverticulitis [44].

Several studies [14,25-27] have associated CLEC7A deletion with modified risk and severity of UC, supporting the notion that CLEC7A SNPs could lead to the formation of a variant Dectin-1 with impaired function. Iliev et al [14] reported that CLEC7A -/- led to more severe colitis in mice, which was alleviated by the use of antifungals. Contrary to these findings, in the study of Wang et al Dectin-1 and Dectin-2 knockout altered bacterial but not fungal microbiota, and conferred a protective effect against dextran sodium sulfate (DSS)-induced colitis in mice [27]. Similarly, Tang et al showed that CLEC7A deletion or antagonism rendered mice refractory to DSS-induced colitis, an effect attributable to an increase in Lactobacillus marinus that triggers Treg expansion in the intestines [26]. This alteration was concomitant with a reduction in antimicrobial peptides induced by Dectin-1 signaling [26]. Furthermore, in human patients suffering from IBD a diminished proportion of closely related Lactobacillus species has been observed, suggesting a possible similar influence of diminished Dectin-1 expression on microbiota that can cause Treg expansion. In mice, upon experimental Candida tropicalis colonization, the protective effect of the CLEC7A -/- deletion was reversed and the mice became largely susceptible to colitis, implying a complex dual effect for CLEC7A on fungal and bacterial gut microbiota. These collective findings suggest that Dectin-1 may play a role in regulating intestinal immune homeostasis through its influence on Treg cell differentiation, achieved via both the modulation of the gut microbiota and the prevention of fungal invasion [26]. A better understanding of how fungi elicit gut inflammation may be useful in the development of better therapies for IBD, particularly for individuals with severe UC carrying Dectin-1 risk alleles.

To conclude, the present study explored the association between CLEC5A and CLEC7A SNPs and the risk for development of CD and UC. Our results highlight the protective effect of CLEC5A rs1285933 GA and AA genotypes against CD development, a finding that contrasts with previously published data. The correlation between CLEC5A and UC was first explored in the present study, yielding a protective effect of the rs1285933 GA genotype. CLEC7A gene SNPs were not associated with a heightened risk for CD, confirming the current literature. CLEC7A rs2078178 AA genotype conferred a 14-fold risk increase for UC development, and could be evaluated as a potential genotypic biomarker in subsequent larger cohorts. CLEC7A rs16910631 CT genotype frequency was also higher among UC patients. Larger and preferably ethnically diverse cohorts are required in order to consolidate the presented findings and shape a robust understanding of the role of CLEC7A and CLEC5A genes in the etiopathogenesis of IBD. Such research could determine whether polymorphisms in genes involved in the explored pathways can serve as prognostic biomarkers for IBD, and whether the associated gene products are candidate molecules for targeted therapeutic interventions.